Review



1 ap  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Cell Signaling Technology Inc 1 ap
    1 Ap, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+cd38/pm41824450-532-10-15?v=Cell+Signaling+Technology+Inc
    Average 86 stars, based on 2 article reviews
    1 ap - by Bioz Stars, 2026-07
    86/100 stars

    Images



    Similar Products

    92
    Miltenyi Biotec pe vio770 miltenyi biotec 130 125 522 rat anti mouse cd4
    Pe Vio770 Miltenyi Biotec 130 125 522 Rat Anti Mouse Cd4, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+cd38/pm41916319-875-86-88?v=Miltenyi+Biotec
    Average 92 stars, based on 1 article reviews
    pe vio770 miltenyi biotec 130 125 522 rat anti mouse cd4 - by Bioz Stars, 2026-07
    92/100 stars
      Buy from Supplier

    94
    OriGene ggtccaagtgatgctcaatggg
    Ggtccaagtgatgctcaatggg, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+cd38/pm42244013-162-8-13?v=OriGene
    Average 94 stars, based on 1 article reviews
    ggtccaagtgatgctcaatggg - by Bioz Stars, 2026-07
    94/100 stars
      Buy from Supplier

    93
    R&D Systems cd38
    Establishment and characterization of a fibrotic macrophage-muscle fibrosis model. a) Brightfield image of unstimulated RAW264.7 cells in the top chamber of a RAW-C2C12 coculture system, b) Brightfield image of C2C12 cells in the bottom chamber under basal coculture conditions, c) Fluorescence image of C2C12 cells in the bottom chamber exhibiting myotube morphology, d) Fluorescence image confirming the absence of fibrotic marker expression in C2C12 cells under basal conditions, e) Brightfield image of LPS-activated RAW264.7 cells in the top chamber, f) Brightfield image of C2C12 cells in the bottom chamber displaying a myofibroblast-like morphology post-LPS activation, g) Fluorescence image of phenotypic transition of C2C12 cells to myofibroblast-like cells, h) Fluorescence image demonstrating fibrotic protein expression in LPS-treated C2C12 cells (magenta arrow indicates <t>CD38</t> cells). Immunostaining images: In panels c) and g), TGF-β, DAPI, and actin are colored red, blue, and green, respectively. In panels d) and h), COL1, α-SMA, CD38, and DAPI are colored red, blue, magenta, and green, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
    Cd38, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+cd38/pmc13059309-44-8-27?v=R%26D+Systems
    Average 93 stars, based on 1 article reviews
    cd38 - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    86
    Cell Signaling Technology Inc 1 ap
    Establishment and characterization of a fibrotic macrophage-muscle fibrosis model. a) Brightfield image of unstimulated RAW264.7 cells in the top chamber of a RAW-C2C12 coculture system, b) Brightfield image of C2C12 cells in the bottom chamber under basal coculture conditions, c) Fluorescence image of C2C12 cells in the bottom chamber exhibiting myotube morphology, d) Fluorescence image confirming the absence of fibrotic marker expression in C2C12 cells under basal conditions, e) Brightfield image of LPS-activated RAW264.7 cells in the top chamber, f) Brightfield image of C2C12 cells in the bottom chamber displaying a myofibroblast-like morphology post-LPS activation, g) Fluorescence image of phenotypic transition of C2C12 cells to myofibroblast-like cells, h) Fluorescence image demonstrating fibrotic protein expression in LPS-treated C2C12 cells (magenta arrow indicates <t>CD38</t> cells). Immunostaining images: In panels c) and g), TGF-β, DAPI, and actin are colored red, blue, and green, respectively. In panels d) and h), COL1, α-SMA, CD38, and DAPI are colored red, blue, magenta, and green, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
    1 Ap, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+cd38/pm41824450-532-10-15?v=Cell+Signaling+Technology+Inc
    Average 86 stars, based on 1 article reviews
    1 ap - by Bioz Stars, 2026-07
    86/100 stars
      Buy from Supplier

    94
    fluidigm 3171007b
    Establishment and characterization of a fibrotic macrophage-muscle fibrosis model. a) Brightfield image of unstimulated RAW264.7 cells in the top chamber of a RAW-C2C12 coculture system, b) Brightfield image of C2C12 cells in the bottom chamber under basal coculture conditions, c) Fluorescence image of C2C12 cells in the bottom chamber exhibiting myotube morphology, d) Fluorescence image confirming the absence of fibrotic marker expression in C2C12 cells under basal conditions, e) Brightfield image of LPS-activated RAW264.7 cells in the top chamber, f) Brightfield image of C2C12 cells in the bottom chamber displaying a myofibroblast-like morphology post-LPS activation, g) Fluorescence image of phenotypic transition of C2C12 cells to myofibroblast-like cells, h) Fluorescence image demonstrating fibrotic protein expression in LPS-treated C2C12 cells (magenta arrow indicates <t>CD38</t> cells). Immunostaining images: In panels c) and g), TGF-β, DAPI, and actin are colored red, blue, and green, respectively. In panels d) and h), COL1, α-SMA, CD38, and DAPI are colored red, blue, magenta, and green, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
    3171007b, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+cd38/pmc12903562-38-10-8?v=fluidigm
    Average 94 stars, based on 1 article reviews
    3171007b - by Bioz Stars, 2026-07
    94/100 stars
      Buy from Supplier

    94
    fluidigm 171yb
    Establishment and characterization of a fibrotic macrophage-muscle fibrosis model. a) Brightfield image of unstimulated RAW264.7 cells in the top chamber of a RAW-C2C12 coculture system, b) Brightfield image of C2C12 cells in the bottom chamber under basal coculture conditions, c) Fluorescence image of C2C12 cells in the bottom chamber exhibiting myotube morphology, d) Fluorescence image confirming the absence of fibrotic marker expression in C2C12 cells under basal conditions, e) Brightfield image of LPS-activated RAW264.7 cells in the top chamber, f) Brightfield image of C2C12 cells in the bottom chamber displaying a myofibroblast-like morphology post-LPS activation, g) Fluorescence image of phenotypic transition of C2C12 cells to myofibroblast-like cells, h) Fluorescence image demonstrating fibrotic protein expression in LPS-treated C2C12 cells (magenta arrow indicates <t>CD38</t> cells). Immunostaining images: In panels c) and g), TGF-β, DAPI, and actin are colored red, blue, and green, respectively. In panels d) and h), COL1, α-SMA, CD38, and DAPI are colored red, blue, magenta, and green, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
    171yb, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+cd38/pmc12903562-38-2-8?v=fluidigm
    Average 94 stars, based on 1 article reviews
    171yb - by Bioz Stars, 2026-07
    94/100 stars
      Buy from Supplier

    93
    R&D Systems antibodies against cd38
    <t>CD38</t> expression and activity increase at late stages of ZIKV infection and correlate with NAD + decline in the brain (A) Total NADase activity measured in the brains of ZIKV-infected and mock-injected mice over the course of infection, showing significant increases from 18 dpi onward ( n ≥ 7 mice per group). (B) Overlay of NADase activity (red line) and NAD + levels (gray line), both relative to mock controls (dashed line), showing an inverse temporal association. (C–H) Relative mRNA expression of Sarm1 , Cd157 , and Cd38 , respectively, in the brains of ZIKV-infected and control mice ( n ≥ 4 mice per group). (D, F, H) Overlays of mRNA expression profiles of Sarm1 (D), Cd157 (F), and Cd38 (H) with NAD + levels (gray line) and ZIKV genomic RNA (yellow line), indicating that Cd38 induction temporally coincides with NAD + decline, while Sarm1 and Cd157 do not. (I) Linear regression shows a positive correlation between total NADase activity and Cd38 mRNA expression ( n = 50). (J) CD38-dependent NADase activity, calculated as the fraction inhibited by the specific CD38 inhibitor 78c ( n ≥ 6 mice per group). (K) CD38-independent NADase activity, which remains low and unchanged during infection ( n ≥ 6 mice per group). (L) On the right, representative Western blot of CD38 protein expression in brain extracts at 24 dpi, with α-tubulin as loading control (representative bands from the same experiment shown in the full blot in ). On the left, quantification of the Western blot bands’ intensities (CD38/α-tubulin) relative to mock ( n ≥ 4 mice per group). Data in panels A, C, E, G, J, K, and L are presented as mean ± SD; panels B, D, F, and H as mean ± SEM (shaded area). Statistical significance was determined by unpaired Student’s t test or Mann–Whitney test, as appropriate. ∗ p ≤ 0.05; ∗∗ p ≤ 0.01; ∗∗∗ p ≤ 0.001.
    Antibodies Against Cd38, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+cd38/pmc12682054-364-21-25?v=R%26D+Systems
    Average 93 stars, based on 1 article reviews
    antibodies against cd38 - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    86
    Servicebio Inc mouse anti human cd38
    A UMAP plot displaying 134,784 immune cells from scRNA-seq datasets of tumor specimens (HPV − , n = 13; HPV + , n = 10), including TIL-Bs (C1-C2), TIL-Ts (C3-C7), NK (C8) and myeloid-derived cells (C9-C12). B Relative abundance of each cluster in each PSCC patient. C , D Bar graph comparing the relative proportions of each cluster ( C ) and major immune types ( D ) between HPV − and HPV + PSCC. P- values were indicated for C1: ** P = 0.0063, C2: ** P = 0.01, C6: ** P = 0.0145 in ( C ) and TIL-Bs: *** P = 0.0007 in ( D ). E Gating strategy for FACS analysis in fresh PSCC specimens. F Histograms showing the relative proportions of total immune cells, TIL-Bs and TIL-Ts in fresh HPV - ( n = 11) and HPV + ( n = 9) PSCC tumors (* P = 0.0151). G Overall survival curves of 85 patients with HPV - ( n = 52) or HPV + ( n = 33) PSCC (* P = 0.0136). H Representative images of PSCC tumor sections with HE staining (left), double-plex IHC staining for CD20 and CD3 (middle), and TLSs (right), marked by black circles in both tumor and non-tumor regions. Scale bar: 2 mm (left and middle), 400 μm (upper right) and 150 μm (lower right). I Quantification of TLSs per tumor area in non-tumor and intra-tumor regions in PSCC ( n = 37) (**** P < 0.0001). J Number of TLSs per tumor area in HPV − ( n = 52) and HPV + ( n = 33) PSCC (** P = 0.0029). K Quantification of the number of CD3 + and CD20 + within TLSs per tumor area in HPV − ( n = 52) and HPV + ( n = 33) PSCC tumor sections by IHC stained (**** P < 0.0001). L Representative immunofluorescence staining for CD3, CD20, <t>CD38</t> and DAPI + nuclei within TLSs in HPV - and HPV + PSCC tumors. Scale bar: 200 μm. M Quantification of the number of CD3 + , CD20 + , and CD38 + within TLSs per tumor area in HPV − ( n = 10) and HPV + ( n = 10) PSCC tumor sections by IF stained. (CD20: * P = 0.0420, CD38: * P = 0.0430). TIL-Bs:Tumor-infiltrating B cells. TIL-Ts: Tumor-infiltrating T cells.TLSs: tertiary lymphoid structures. A two-sided unpaired Student’s t test was used in ( C ), ( D ), ( F ), ( J ), ( K ) and ( M ). A two-sided paired Student’s t test for ( I ), and a two-sided log-rank (Mantel–Cox) test in ( G ). Data are presented as mean ± s.e.m. ns: not significant ( P > 0.05). Source data are provided as a Source Data file.
    Mouse Anti Human Cd38, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+cd38/pmc12816729-368-36-38?v=Servicebio+Inc
    Average 86 stars, based on 1 article reviews
    mouse anti human cd38 - by Bioz Stars, 2026-07
    86/100 stars
      Buy from Supplier

    93
    Cusabio enzyme linked immunosorbent assay elisa kits
    A UMAP plot displaying 134,784 immune cells from scRNA-seq datasets of tumor specimens (HPV − , n = 13; HPV + , n = 10), including TIL-Bs (C1-C2), TIL-Ts (C3-C7), NK (C8) and myeloid-derived cells (C9-C12). B Relative abundance of each cluster in each PSCC patient. C , D Bar graph comparing the relative proportions of each cluster ( C ) and major immune types ( D ) between HPV − and HPV + PSCC. P- values were indicated for C1: ** P = 0.0063, C2: ** P = 0.01, C6: ** P = 0.0145 in ( C ) and TIL-Bs: *** P = 0.0007 in ( D ). E Gating strategy for FACS analysis in fresh PSCC specimens. F Histograms showing the relative proportions of total immune cells, TIL-Bs and TIL-Ts in fresh HPV - ( n = 11) and HPV + ( n = 9) PSCC tumors (* P = 0.0151). G Overall survival curves of 85 patients with HPV - ( n = 52) or HPV + ( n = 33) PSCC (* P = 0.0136). H Representative images of PSCC tumor sections with HE staining (left), double-plex IHC staining for CD20 and CD3 (middle), and TLSs (right), marked by black circles in both tumor and non-tumor regions. Scale bar: 2 mm (left and middle), 400 μm (upper right) and 150 μm (lower right). I Quantification of TLSs per tumor area in non-tumor and intra-tumor regions in PSCC ( n = 37) (**** P < 0.0001). J Number of TLSs per tumor area in HPV − ( n = 52) and HPV + ( n = 33) PSCC (** P = 0.0029). K Quantification of the number of CD3 + and CD20 + within TLSs per tumor area in HPV − ( n = 52) and HPV + ( n = 33) PSCC tumor sections by IHC stained (**** P < 0.0001). L Representative immunofluorescence staining for CD3, CD20, <t>CD38</t> and DAPI + nuclei within TLSs in HPV - and HPV + PSCC tumors. Scale bar: 200 μm. M Quantification of the number of CD3 + , CD20 + , and CD38 + within TLSs per tumor area in HPV − ( n = 10) and HPV + ( n = 10) PSCC tumor sections by IF stained. (CD20: * P = 0.0420, CD38: * P = 0.0430). TIL-Bs:Tumor-infiltrating B cells. TIL-Ts: Tumor-infiltrating T cells.TLSs: tertiary lymphoid structures. A two-sided unpaired Student’s t test was used in ( C ), ( D ), ( F ), ( J ), ( K ) and ( M ). A two-sided paired Student’s t test for ( I ), and a two-sided log-rank (Mantel–Cox) test in ( G ). Data are presented as mean ± s.e.m. ns: not significant ( P > 0.05). Source data are provided as a Source Data file.
    Enzyme Linked Immunosorbent Assay Elisa Kits, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+cd38/pmc12781658-159-10-16?v=Cusabio
    Average 93 stars, based on 1 article reviews
    enzyme linked immunosorbent assay elisa kits - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    Establishment and characterization of a fibrotic macrophage-muscle fibrosis model. a) Brightfield image of unstimulated RAW264.7 cells in the top chamber of a RAW-C2C12 coculture system, b) Brightfield image of C2C12 cells in the bottom chamber under basal coculture conditions, c) Fluorescence image of C2C12 cells in the bottom chamber exhibiting myotube morphology, d) Fluorescence image confirming the absence of fibrotic marker expression in C2C12 cells under basal conditions, e) Brightfield image of LPS-activated RAW264.7 cells in the top chamber, f) Brightfield image of C2C12 cells in the bottom chamber displaying a myofibroblast-like morphology post-LPS activation, g) Fluorescence image of phenotypic transition of C2C12 cells to myofibroblast-like cells, h) Fluorescence image demonstrating fibrotic protein expression in LPS-treated C2C12 cells (magenta arrow indicates CD38 cells). Immunostaining images: In panels c) and g), TGF-β, DAPI, and actin are colored red, blue, and green, respectively. In panels d) and h), COL1, α-SMA, CD38, and DAPI are colored red, blue, magenta, and green, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

    Journal: Materials Today Bio

    Article Title: Injectable antifibrotic drug-loaded hydrogels reduce fibrosis and restore myogenesis by enhancing mitochondrial metabolism and cell mechanics in an in vitro coculture model

    doi: 10.1016/j.mtbio.2026.103033

    Figure Lengend Snippet: Establishment and characterization of a fibrotic macrophage-muscle fibrosis model. a) Brightfield image of unstimulated RAW264.7 cells in the top chamber of a RAW-C2C12 coculture system, b) Brightfield image of C2C12 cells in the bottom chamber under basal coculture conditions, c) Fluorescence image of C2C12 cells in the bottom chamber exhibiting myotube morphology, d) Fluorescence image confirming the absence of fibrotic marker expression in C2C12 cells under basal conditions, e) Brightfield image of LPS-activated RAW264.7 cells in the top chamber, f) Brightfield image of C2C12 cells in the bottom chamber displaying a myofibroblast-like morphology post-LPS activation, g) Fluorescence image of phenotypic transition of C2C12 cells to myofibroblast-like cells, h) Fluorescence image demonstrating fibrotic protein expression in LPS-treated C2C12 cells (magenta arrow indicates CD38 cells). Immunostaining images: In panels c) and g), TGF-β, DAPI, and actin are colored red, blue, and green, respectively. In panels d) and h), COL1, α-SMA, CD38, and DAPI are colored red, blue, magenta, and green, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

    Article Snippet: Mouse monoclonal antibodies against myosin heavy chain (MyHC), CD38, and transforming growth factor-β (TGF-β), as well as rabbit polyclonal α-smooth muscle actin (α-SMA) antibodies, were purchased from R&D Systems (USA).

    Techniques: Fluorescence, Marker, Expressing, Activation Assay, Immunostaining

    CD38 expression and activity increase at late stages of ZIKV infection and correlate with NAD + decline in the brain (A) Total NADase activity measured in the brains of ZIKV-infected and mock-injected mice over the course of infection, showing significant increases from 18 dpi onward ( n ≥ 7 mice per group). (B) Overlay of NADase activity (red line) and NAD + levels (gray line), both relative to mock controls (dashed line), showing an inverse temporal association. (C–H) Relative mRNA expression of Sarm1 , Cd157 , and Cd38 , respectively, in the brains of ZIKV-infected and control mice ( n ≥ 4 mice per group). (D, F, H) Overlays of mRNA expression profiles of Sarm1 (D), Cd157 (F), and Cd38 (H) with NAD + levels (gray line) and ZIKV genomic RNA (yellow line), indicating that Cd38 induction temporally coincides with NAD + decline, while Sarm1 and Cd157 do not. (I) Linear regression shows a positive correlation between total NADase activity and Cd38 mRNA expression ( n = 50). (J) CD38-dependent NADase activity, calculated as the fraction inhibited by the specific CD38 inhibitor 78c ( n ≥ 6 mice per group). (K) CD38-independent NADase activity, which remains low and unchanged during infection ( n ≥ 6 mice per group). (L) On the right, representative Western blot of CD38 protein expression in brain extracts at 24 dpi, with α-tubulin as loading control (representative bands from the same experiment shown in the full blot in ). On the left, quantification of the Western blot bands’ intensities (CD38/α-tubulin) relative to mock ( n ≥ 4 mice per group). Data in panels A, C, E, G, J, K, and L are presented as mean ± SD; panels B, D, F, and H as mean ± SEM (shaded area). Statistical significance was determined by unpaired Student’s t test or Mann–Whitney test, as appropriate. ∗ p ≤ 0.05; ∗∗ p ≤ 0.01; ∗∗∗ p ≤ 0.001.

    Journal: iScience

    Article Title: CD38 is a key mediator of NAD + depletion in the brain of ZIKV-infected mice

    doi: 10.1016/j.isci.2025.114018

    Figure Lengend Snippet: CD38 expression and activity increase at late stages of ZIKV infection and correlate with NAD + decline in the brain (A) Total NADase activity measured in the brains of ZIKV-infected and mock-injected mice over the course of infection, showing significant increases from 18 dpi onward ( n ≥ 7 mice per group). (B) Overlay of NADase activity (red line) and NAD + levels (gray line), both relative to mock controls (dashed line), showing an inverse temporal association. (C–H) Relative mRNA expression of Sarm1 , Cd157 , and Cd38 , respectively, in the brains of ZIKV-infected and control mice ( n ≥ 4 mice per group). (D, F, H) Overlays of mRNA expression profiles of Sarm1 (D), Cd157 (F), and Cd38 (H) with NAD + levels (gray line) and ZIKV genomic RNA (yellow line), indicating that Cd38 induction temporally coincides with NAD + decline, while Sarm1 and Cd157 do not. (I) Linear regression shows a positive correlation between total NADase activity and Cd38 mRNA expression ( n = 50). (J) CD38-dependent NADase activity, calculated as the fraction inhibited by the specific CD38 inhibitor 78c ( n ≥ 6 mice per group). (K) CD38-independent NADase activity, which remains low and unchanged during infection ( n ≥ 6 mice per group). (L) On the right, representative Western blot of CD38 protein expression in brain extracts at 24 dpi, with α-tubulin as loading control (representative bands from the same experiment shown in the full blot in ). On the left, quantification of the Western blot bands’ intensities (CD38/α-tubulin) relative to mock ( n ≥ 4 mice per group). Data in panels A, C, E, G, J, K, and L are presented as mean ± SD; panels B, D, F, and H as mean ± SEM (shaded area). Statistical significance was determined by unpaired Student’s t test or Mann–Whitney test, as appropriate. ∗ p ≤ 0.05; ∗∗ p ≤ 0.01; ∗∗∗ p ≤ 0.001.

    Article Snippet: Proteins were separated by electrophoresis on 15% SDS–polyacrylamide gels (SDS-PAGE), transferred to nitrocellulose membranes (Bio-Rad, California, USA), and probed with primary antibodies against CD38 (AF4947, R&D Systems, Minnesota, USA) or NAMPT (AG-20A-0034-C050, AdipoGen Life Sciences, California, USA), using concentrations recommended by the manufacturers and previously validated in-house.

    Techniques: Expressing, Activity Assay, Infection, Injection, Control, Western Blot, MANN-WHITNEY

    CD38 inhibition prevents NAD + depletion in the brains of ZIKV-infected mice (A) Schematic representation of the experimental design. Neonatal mice were subcutaneously infected with ZIKV at postnatal day 3 (P3). At 21 days post-infection (dpi), animals received a unilateral intracerebroventricular (i.c.v.) injection of the CD38-blocking antibody Ab68 (5.76 μg) or vehicle (Veh), and brains were collected at 24 dpi for analysis. (B) NAD + hydrolase activity in brain tissue. (C) Quantification of total NAD + levels in brain tissue. Data are presented as mean ± SD. Statistical analyses were performed using an unpaired Student’s t test ( n ≥ 7 mice per group). ∗p ≤ 0.05; ∗∗∗∗p ≤ 0.0001.

    Journal: iScience

    Article Title: CD38 is a key mediator of NAD + depletion in the brain of ZIKV-infected mice

    doi: 10.1016/j.isci.2025.114018

    Figure Lengend Snippet: CD38 inhibition prevents NAD + depletion in the brains of ZIKV-infected mice (A) Schematic representation of the experimental design. Neonatal mice were subcutaneously infected with ZIKV at postnatal day 3 (P3). At 21 days post-infection (dpi), animals received a unilateral intracerebroventricular (i.c.v.) injection of the CD38-blocking antibody Ab68 (5.76 μg) or vehicle (Veh), and brains were collected at 24 dpi for analysis. (B) NAD + hydrolase activity in brain tissue. (C) Quantification of total NAD + levels in brain tissue. Data are presented as mean ± SD. Statistical analyses were performed using an unpaired Student’s t test ( n ≥ 7 mice per group). ∗p ≤ 0.05; ∗∗∗∗p ≤ 0.0001.

    Article Snippet: Proteins were separated by electrophoresis on 15% SDS–polyacrylamide gels (SDS-PAGE), transferred to nitrocellulose membranes (Bio-Rad, California, USA), and probed with primary antibodies against CD38 (AF4947, R&D Systems, Minnesota, USA) or NAMPT (AG-20A-0034-C050, AdipoGen Life Sciences, California, USA), using concentrations recommended by the manufacturers and previously validated in-house.

    Techniques: Inhibition, Infection, Injection, Blocking Assay, Activity Assay

    NAMPT is induced in the brain of ZIKV-infected mice (A) Relative mRNA expression of Nampt in the brains of ZIKV-infected and mock-injected mice across time points post-infection ( n ≥ 4 mice per group). (B) Overlay of Nampt mRNA expression (blue line), total NADase activity (red line), NAD + levels (gray line), and ZIKV genomic RNA (yellow line), all relative to mock controls (dashed line). (C–F) Correlation analyses between Nampt mRNA expression and (C) ZIKV genomic RNA, (D) Parp12 , (E) Parp10 , and (F) Cd38 mRNA expression. Nampt shows a strong correlation with viral load and early-induced Parps , but a weak correlation with Cd38 . (G) Representative Western blot of NAMPT protein expression in the brains of ZIKV-infected and mock-injected mice at 24 days post-infection (dpi; representative bands from the same experiment shown in the full blot in ).. HPRT was used as a loading control. The right panel shows quantification of NAMPT protein levels (NAMPT/HPRT ratio), normalized to mock controls ( n ≥ 4 mice per group). Data in panels A and G are presented as mean ± SD; panel B as mean ± SEM (shaded area). Correlations were assessed by linear regression analysis. Statistical analyses were performed using an unpaired Student’s t test or Mann–Whitney test, as appropriate. ∗ p ≤ 0.05; ∗∗ p ≤ 0.01; ∗∗∗ p ≤ 0.001.

    Journal: iScience

    Article Title: CD38 is a key mediator of NAD + depletion in the brain of ZIKV-infected mice

    doi: 10.1016/j.isci.2025.114018

    Figure Lengend Snippet: NAMPT is induced in the brain of ZIKV-infected mice (A) Relative mRNA expression of Nampt in the brains of ZIKV-infected and mock-injected mice across time points post-infection ( n ≥ 4 mice per group). (B) Overlay of Nampt mRNA expression (blue line), total NADase activity (red line), NAD + levels (gray line), and ZIKV genomic RNA (yellow line), all relative to mock controls (dashed line). (C–F) Correlation analyses between Nampt mRNA expression and (C) ZIKV genomic RNA, (D) Parp12 , (E) Parp10 , and (F) Cd38 mRNA expression. Nampt shows a strong correlation with viral load and early-induced Parps , but a weak correlation with Cd38 . (G) Representative Western blot of NAMPT protein expression in the brains of ZIKV-infected and mock-injected mice at 24 days post-infection (dpi; representative bands from the same experiment shown in the full blot in ).. HPRT was used as a loading control. The right panel shows quantification of NAMPT protein levels (NAMPT/HPRT ratio), normalized to mock controls ( n ≥ 4 mice per group). Data in panels A and G are presented as mean ± SD; panel B as mean ± SEM (shaded area). Correlations were assessed by linear regression analysis. Statistical analyses were performed using an unpaired Student’s t test or Mann–Whitney test, as appropriate. ∗ p ≤ 0.05; ∗∗ p ≤ 0.01; ∗∗∗ p ≤ 0.001.

    Article Snippet: Proteins were separated by electrophoresis on 15% SDS–polyacrylamide gels (SDS-PAGE), transferred to nitrocellulose membranes (Bio-Rad, California, USA), and probed with primary antibodies against CD38 (AF4947, R&D Systems, Minnesota, USA) or NAMPT (AG-20A-0034-C050, AdipoGen Life Sciences, California, USA), using concentrations recommended by the manufacturers and previously validated in-house.

    Techniques: Infection, Expressing, Injection, Activity Assay, Western Blot, Control, MANN-WHITNEY

    Proinflammatory cytokine expression precedes CD38 induction in the brains of ZIKV-infected mice (A, C, E) Relative mRNA expression of Il6 and Tnf (linear scale), and Ccl5/Rantes (Log 10 -transformed) in the brains of ZIKV-infected and mock-injected mice across time points post-infection ( n ≥ 3 mice per group). All three inflammatory mediators were significantly upregulated during the early and mid-stages of infection. (B, D, F) Overlay of Il6 (B), Tnf (D), and Rantes – log 10 scale (F) mRNA expression profiles (purple line) with Cd38 mRNA (red line), NAD + levels (gray line), and ZIKV genomic RNA (yellow line), all relative to mock controls (dashed line). (G) Brain IL-6 protein levels determined by ELISA ( n ≥ 5 mice per group). The temporal pattern shows that cytokine and chemokine induction precede Cd38 expression, suggesting that neuroinflammation may contribute to the upregulation of CD38. Data in panels A, C, and E are presented as mean ± SD; panels B, D, and F as mean ± SEM (shaded area). Statistical analyses were performed using an unpaired Student’s t test or Mann–Whitney test, as appropriate. ∗ p ≤ 0.05; ∗∗ p ≤ 0.01; ∗∗∗ p ≤ 0.001.

    Journal: iScience

    Article Title: CD38 is a key mediator of NAD + depletion in the brain of ZIKV-infected mice

    doi: 10.1016/j.isci.2025.114018

    Figure Lengend Snippet: Proinflammatory cytokine expression precedes CD38 induction in the brains of ZIKV-infected mice (A, C, E) Relative mRNA expression of Il6 and Tnf (linear scale), and Ccl5/Rantes (Log 10 -transformed) in the brains of ZIKV-infected and mock-injected mice across time points post-infection ( n ≥ 3 mice per group). All three inflammatory mediators were significantly upregulated during the early and mid-stages of infection. (B, D, F) Overlay of Il6 (B), Tnf (D), and Rantes – log 10 scale (F) mRNA expression profiles (purple line) with Cd38 mRNA (red line), NAD + levels (gray line), and ZIKV genomic RNA (yellow line), all relative to mock controls (dashed line). (G) Brain IL-6 protein levels determined by ELISA ( n ≥ 5 mice per group). The temporal pattern shows that cytokine and chemokine induction precede Cd38 expression, suggesting that neuroinflammation may contribute to the upregulation of CD38. Data in panels A, C, and E are presented as mean ± SD; panels B, D, and F as mean ± SEM (shaded area). Statistical analyses were performed using an unpaired Student’s t test or Mann–Whitney test, as appropriate. ∗ p ≤ 0.05; ∗∗ p ≤ 0.01; ∗∗∗ p ≤ 0.001.

    Article Snippet: Proteins were separated by electrophoresis on 15% SDS–polyacrylamide gels (SDS-PAGE), transferred to nitrocellulose membranes (Bio-Rad, California, USA), and probed with primary antibodies against CD38 (AF4947, R&D Systems, Minnesota, USA) or NAMPT (AG-20A-0034-C050, AdipoGen Life Sciences, California, USA), using concentrations recommended by the manufacturers and previously validated in-house.

    Techniques: Expressing, Infection, Transformation Assay, Injection, Enzyme-linked Immunosorbent Assay, MANN-WHITNEY

    Infiltrating immune cells contribute to increased CD38 expression in the brains of ZIKV-infected mice (A) On the left, representative dot plots show the gating strategy used to identify CD45 lo CD11b + (putative resting microglia), CD45 hi CD11b + (infiltrating myeloid cells), and CD45 + CD11b − (lymphoid cells) populations. On the right, graphs showing the frequency of each population in ZIKV-infected and mock-injected mice ( n ≥ 5 mice per group). (B) Representative dot plots and quantification of CD11b + TMEM119 + , CD11b + TMEM119 + , and CD11b + TMEM119 - populations in the brains of infected and control mice ( n ≥ 6 mice per group), with the respective graphs showing the frequency of each population. (C–E) Representative histograms and quantification of CD38 expression (median fluorescence intensity, MFI) in CD11b + TMEM119 + (C) CD11b − TMEM119 + (D), and CD11b + TMEM119 - (E) populations. (F and G) Gating and quantification of CD3 + T cells (F) and corresponding CD38 expression (G). (H and I) Gating and quantification of CD19 + B cells (H) and corresponding CD38 expression (I). All graphs represent mean ± SD. Gating was based on negative controls; histogram quantification was performed using MFI, and curves were normalized to unit area. Statistical analyses were performed using an unpaired Student’s t test or Mann–Whitney test, as appropriate. ∗ p ≤ 0.05; ∗∗ p ≤ 0.01; ∗∗∗∗ p ≤ 0.0001.

    Journal: iScience

    Article Title: CD38 is a key mediator of NAD + depletion in the brain of ZIKV-infected mice

    doi: 10.1016/j.isci.2025.114018

    Figure Lengend Snippet: Infiltrating immune cells contribute to increased CD38 expression in the brains of ZIKV-infected mice (A) On the left, representative dot plots show the gating strategy used to identify CD45 lo CD11b + (putative resting microglia), CD45 hi CD11b + (infiltrating myeloid cells), and CD45 + CD11b − (lymphoid cells) populations. On the right, graphs showing the frequency of each population in ZIKV-infected and mock-injected mice ( n ≥ 5 mice per group). (B) Representative dot plots and quantification of CD11b + TMEM119 + , CD11b + TMEM119 + , and CD11b + TMEM119 - populations in the brains of infected and control mice ( n ≥ 6 mice per group), with the respective graphs showing the frequency of each population. (C–E) Representative histograms and quantification of CD38 expression (median fluorescence intensity, MFI) in CD11b + TMEM119 + (C) CD11b − TMEM119 + (D), and CD11b + TMEM119 - (E) populations. (F and G) Gating and quantification of CD3 + T cells (F) and corresponding CD38 expression (G). (H and I) Gating and quantification of CD19 + B cells (H) and corresponding CD38 expression (I). All graphs represent mean ± SD. Gating was based on negative controls; histogram quantification was performed using MFI, and curves were normalized to unit area. Statistical analyses were performed using an unpaired Student’s t test or Mann–Whitney test, as appropriate. ∗ p ≤ 0.05; ∗∗ p ≤ 0.01; ∗∗∗∗ p ≤ 0.0001.

    Article Snippet: Proteins were separated by electrophoresis on 15% SDS–polyacrylamide gels (SDS-PAGE), transferred to nitrocellulose membranes (Bio-Rad, California, USA), and probed with primary antibodies against CD38 (AF4947, R&D Systems, Minnesota, USA) or NAMPT (AG-20A-0034-C050, AdipoGen Life Sciences, California, USA), using concentrations recommended by the manufacturers and previously validated in-house.

    Techniques: Expressing, Infection, Injection, Control, Fluorescence, MANN-WHITNEY

    A UMAP plot displaying 134,784 immune cells from scRNA-seq datasets of tumor specimens (HPV − , n = 13; HPV + , n = 10), including TIL-Bs (C1-C2), TIL-Ts (C3-C7), NK (C8) and myeloid-derived cells (C9-C12). B Relative abundance of each cluster in each PSCC patient. C , D Bar graph comparing the relative proportions of each cluster ( C ) and major immune types ( D ) between HPV − and HPV + PSCC. P- values were indicated for C1: ** P = 0.0063, C2: ** P = 0.01, C6: ** P = 0.0145 in ( C ) and TIL-Bs: *** P = 0.0007 in ( D ). E Gating strategy for FACS analysis in fresh PSCC specimens. F Histograms showing the relative proportions of total immune cells, TIL-Bs and TIL-Ts in fresh HPV - ( n = 11) and HPV + ( n = 9) PSCC tumors (* P = 0.0151). G Overall survival curves of 85 patients with HPV - ( n = 52) or HPV + ( n = 33) PSCC (* P = 0.0136). H Representative images of PSCC tumor sections with HE staining (left), double-plex IHC staining for CD20 and CD3 (middle), and TLSs (right), marked by black circles in both tumor and non-tumor regions. Scale bar: 2 mm (left and middle), 400 μm (upper right) and 150 μm (lower right). I Quantification of TLSs per tumor area in non-tumor and intra-tumor regions in PSCC ( n = 37) (**** P < 0.0001). J Number of TLSs per tumor area in HPV − ( n = 52) and HPV + ( n = 33) PSCC (** P = 0.0029). K Quantification of the number of CD3 + and CD20 + within TLSs per tumor area in HPV − ( n = 52) and HPV + ( n = 33) PSCC tumor sections by IHC stained (**** P < 0.0001). L Representative immunofluorescence staining for CD3, CD20, CD38 and DAPI + nuclei within TLSs in HPV - and HPV + PSCC tumors. Scale bar: 200 μm. M Quantification of the number of CD3 + , CD20 + , and CD38 + within TLSs per tumor area in HPV − ( n = 10) and HPV + ( n = 10) PSCC tumor sections by IF stained. (CD20: * P = 0.0420, CD38: * P = 0.0430). TIL-Bs:Tumor-infiltrating B cells. TIL-Ts: Tumor-infiltrating T cells.TLSs: tertiary lymphoid structures. A two-sided unpaired Student’s t test was used in ( C ), ( D ), ( F ), ( J ), ( K ) and ( M ). A two-sided paired Student’s t test for ( I ), and a two-sided log-rank (Mantel–Cox) test in ( G ). Data are presented as mean ± s.e.m. ns: not significant ( P > 0.05). Source data are provided as a Source Data file.

    Journal: Nature Communications

    Article Title: A B cell-IgA-epithelial axis enhances antitumor immunity and improves outcome in HPV-associated penile squamous cell carcinoma

    doi: 10.1038/s41467-025-67356-6

    Figure Lengend Snippet: A UMAP plot displaying 134,784 immune cells from scRNA-seq datasets of tumor specimens (HPV − , n = 13; HPV + , n = 10), including TIL-Bs (C1-C2), TIL-Ts (C3-C7), NK (C8) and myeloid-derived cells (C9-C12). B Relative abundance of each cluster in each PSCC patient. C , D Bar graph comparing the relative proportions of each cluster ( C ) and major immune types ( D ) between HPV − and HPV + PSCC. P- values were indicated for C1: ** P = 0.0063, C2: ** P = 0.01, C6: ** P = 0.0145 in ( C ) and TIL-Bs: *** P = 0.0007 in ( D ). E Gating strategy for FACS analysis in fresh PSCC specimens. F Histograms showing the relative proportions of total immune cells, TIL-Bs and TIL-Ts in fresh HPV - ( n = 11) and HPV + ( n = 9) PSCC tumors (* P = 0.0151). G Overall survival curves of 85 patients with HPV - ( n = 52) or HPV + ( n = 33) PSCC (* P = 0.0136). H Representative images of PSCC tumor sections with HE staining (left), double-plex IHC staining for CD20 and CD3 (middle), and TLSs (right), marked by black circles in both tumor and non-tumor regions. Scale bar: 2 mm (left and middle), 400 μm (upper right) and 150 μm (lower right). I Quantification of TLSs per tumor area in non-tumor and intra-tumor regions in PSCC ( n = 37) (**** P < 0.0001). J Number of TLSs per tumor area in HPV − ( n = 52) and HPV + ( n = 33) PSCC (** P = 0.0029). K Quantification of the number of CD3 + and CD20 + within TLSs per tumor area in HPV − ( n = 52) and HPV + ( n = 33) PSCC tumor sections by IHC stained (**** P < 0.0001). L Representative immunofluorescence staining for CD3, CD20, CD38 and DAPI + nuclei within TLSs in HPV - and HPV + PSCC tumors. Scale bar: 200 μm. M Quantification of the number of CD3 + , CD20 + , and CD38 + within TLSs per tumor area in HPV − ( n = 10) and HPV + ( n = 10) PSCC tumor sections by IF stained. (CD20: * P = 0.0420, CD38: * P = 0.0430). TIL-Bs:Tumor-infiltrating B cells. TIL-Ts: Tumor-infiltrating T cells.TLSs: tertiary lymphoid structures. A two-sided unpaired Student’s t test was used in ( C ), ( D ), ( F ), ( J ), ( K ) and ( M ). A two-sided paired Student’s t test for ( I ), and a two-sided log-rank (Mantel–Cox) test in ( G ). Data are presented as mean ± s.e.m. ns: not significant ( P > 0.05). Source data are provided as a Source Data file.

    Article Snippet: Primary antibodies were mouse-anti-human KRT5 (ZsBio, TA800727), mouse-anti-human CD45 (ZsBio, ZM-0183), mouse-anti-human CD31 (ZsBio, ZM-0044), rabbit-anti-human VIM (Abram, ab92547), mouse-anti-human CD3 (Servicebio, GB12014), mouse anti-human CD4 (ZsBio, ZM-0418), mouse-anti-human CD8 (Servicebio, GB12068), mouse-anti-human CD20 (Servicebio, GB14030), mouse-anti-human CD38 (Servicebio, GB114831 ), mouse-anti-human CD56 (ZsBio, ZM-0057), rabbit-anti-human CD86 (CST, 91882S), rabbit-anti-human IgA (Abcam, ab124716), rabbit-anti-human PIGR (Abcam, ab96196).

    Techniques: Derivative Assay, Staining, Immunohistochemistry, Immunofluorescence